Chinese Medical Sciences Journal ›› 2018, Vol. 33 ›› Issue (3): 143-151.doi: 10.24920/11815
• Original Article • Previous Articles Next Articles
Tian Ningyu, Qi Yingjiao, Hu Yan, Yin Bin, Yuan Jiangang, Qiang Boqin, Peng Xiaozhong(), Han Wei(
)
Published:
2018-09-30
Online:
2018-06-01
Contact:
Peng Xiaozhong,Han Wei
E-mail:hanwei2012@ibms.pumc.edu.cn;pengxiaozhong@pumc.edu.cn
The authors transfected UNR siRNAs in glioma cells and observed cell proliferation and migration, and scratch wound-healing assay revealing knockdown of UNR dramatically inhibited the cell migration. |
Tian Ningyu, Qi Yingjiao, Hu Yan, Yin Bin, Yuan Jiangang, Qiang Boqin, Peng Xiaozhong, Han Wei. RNA-binding Protein UNR Promotes Glioma Cell Migration and Regulates the Expression of Ribosomal Protein L9[J].Chinese Medical Sciences Journal, 2018, 33(3): 143-151.
Add to citation manager EndNote|Reference Manager|ProCite|BibTeX|RefWorks
"
Name | Forward (5’-3’) | Reverse (5’-3’) |
---|---|---|
GUSB | CAAGCATGAGGATGCGGACA | GCTGGTACGGAAAGCGTTGG |
PABPC1 | CAGGCTCACCTCACTAACCAG | GGTAGGGGTTGATTACAGGGT |
IER3 | CAGCCGCAGGGTTCTCTAC | GATCTGGCAGAAGACGATGGT |
PTEN | ACAAAGCCAACCGATACTTTTCTC | GAAGTTGAACTGCTAGCCTCTGG |
RPL22L1 | GCAATTTCTACGGGAGAAGGTT | ACTCGAAGCCAATCACGAAGA |
RPL9 | GCACAGTTATCGTGAAGGGC | TTACCCCACCATTTGTCAACC |
TIMP2 | FGCCAAAGCGGTCAGTGAGAA | GGAGGGGGCCGTGTAGATAA |
TMEM47 | CAGCAGCGATTGGCAGATTG | TCCCACGCAGATAGAAATCAAAC |
Figure 1.
Upstream-of-N-Ras (UNR) is upregulated in glioma cell lines and tissues compared with normal human astrocytes and brain tissues. A. UNR mRNA expression level in whole genome gene profiling of glioma samples from the Chinese Glioma Genome Atlas (CGGA, http://www.cgcg.org.cn); Grade Ⅱ (n=126), Grade Ⅲ (n=51), Grade Ⅳ (n=128) (*P<0.05, **P<0.005, ***P<0.001, Student’s t-test). B. Kaplan-Meier curves showing high expression levels of UNR correlated with poor patient survival according to the CGGA database. C. Real-time PCR analysis of the relative UNR mRNA expression level in normal human brain (n=5), Grade Ⅱ (n=11), Grade Ⅲ (n=20), and Grade Ⅳ (n=32) glioma tissues (*P<0.05, ***P<0.001, Student’s t-test). D. Relative UNR protein levels in normal brain (n=7), Grade Ⅱ (n=12), Grade Ⅲ (n=24), and Grade Ⅳ (n=47) glioma tissues analyzed by western blot (*P<0.05, **P<0.01, Student’s t-test). E. Western blot showing the relative UNR protein expression level in 3 normal human astrocyte cell lines and 9 glioma cell lines."
Figure 2.
Knockdown of UNR inhibits glioma cell migration. A. Western blot analysis of UNR expression in 3 glioma cell lines (A172, LN18 and HS683) transiently transfected with the control siRNA or UNR siRNA for 48 hours. β-Actin was used as a loading control. B. MTS assay on 3 glioma cell lines after transfection with the control siRNA or UNR siRNA as above. The data have no statistical significance compared with the control siRNA. C, D. Wound-healing assays in HS683 and LN18 cells were performed after infection with control siRNA and UNR-siRNA for 0-72 hours. The assays in A172 cells were performed after infection with control siRNA and UNR-siRNA for 0-36 hours. Pictures were taken during this period. The graph represents the width of the remaining open wound calculated in relation to time 0 (*P<0.05 compared with control siRNA, student’s t-test). All samples were treated in triplicate in each experiment. Each assay was repeated three times."
Figure 3.
UNR binds 3’UTR of biotin-labeled candidate mRNAs. A. Real-time PCR of the candidate mRNAs by RNA binding protein immunoprecipitation of UNR antibodies in LN18 cell lysates. B. Schematic of the indicated candidate mRNAs. The red fragments represent the iCLIP-seq sequence, and the black fragments represent the probe sequences that were designed between 100 bp and 500 bp for the biotin pull-down assay to protect their secondary binding structures. C. Biotin pull-down analysis of complexes formed in vitro using biotin-labelled candidate mRNA segments (shown in B) in LN18 cell lysates."
Figure 4.
Downregulation of UNR inhibits the expression of RPL9 and RPL9 has high expression levels in gliomas. A. Knockdown of UNR inhibits the expression of RPL9 in the glioma cell lines assayed by western blot. B. RPL9 has a higher expression level in gliomas than in normal tissues in the TCGA and GTEx projects by using the GEPIA website (GBM: glioblastoma multiform, LGG: low grade glioma). Red: glioma patients. Gray: normal patients. C. Western blot showing the RPL9 protein levels in normal human astrocyte and glioma cell lines. D. Western blot analysis of RPL9 and vimentin expression in A172 and T98G cells transiently transfected with the control siRNA (SiNC) or RPL9 siRNA for 48 hours."
1. |
Marchese D, de Groot NS, Lorenzo Gotor N , et al. Advances in the characterization of RNA-binding proteins. Wiley Interdiscip Rev RNA 2016; 7(6):793-810. doi: 10.1002/wrna.1378.
doi: 10.1002/wrna.1378 pmid: 27503141 |
2. |
Campos-Melo D, Droppelmann CA, Volkening K , et al. RNA-binding proteins as molecular links between cancer and neurodegeneration. Biogerontology 2014; 15(6):587-610. doi: 10.1007/s10522-014-9531-2.
doi: 10.1007/s10522-014-9531-2 pmid: 25231915 |
3. |
Han W, Xin Z, Zhao Z , et al. RNA-binding protein PCBP2 modulates glioma growth by regulating FHL3. J Clin Invest 2013; 123(5):2103-18. doi: 10.1172/JCI61820.
doi: 10.1172/JCI61820 pmid: 3635714 |
4. |
Jeffers M, Paciucci R, Pellicer A . Characterization of UNR: a gene closely linked to N-ras. Nucleic Acids Res 1990; 18(16):4891-9.
doi: 10.1093/nar/18.16.4883 pmid: 331975 |
5. |
Hunt SL, Hsuan JJ, Totty N , et al. UNR, a cellular cytoplasmic RNA-binding protein with five cold-shock domains, is required for internal initiation of translation of human rhinovirus RNA. Genes Dev 1999; 13(4):437-48.
doi: 10.1101/gad.13.4.437 |
6. |
Boussadia O, Niepmann M, Creancier L , et al. UNR is required in vivo for efficient initiation of translation from the internal ribosome entry sites of both rhinovirus and poliovirus. J Virol 2003; 77(6):3353-9.
doi: 10.1128/JVI.77.6.3353-3359.2003 |
7. |
Cornelis S, Tinton SA, Schepens B , et al. UNR translation can be driven by an IRES element that is negatively regulated by polypyrimidine tract binding protein. Nucleic Acids Res 2005; 33(10):3095-108.
doi: 10.1093/nar/gki611 |
8. | Dormoy-Raclet V, Markovits J, Jacquemin-Sablon A , et al. Regulation of UNR expression by 5’- and 3’-untranslated regions of its mRNA through modulation of stability and IRES mediated translation. RNA Biol 2005; 2(3):e27-35. |
9. |
Patel GP, Ma S, Bag J . The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res 2005; 33(22):7074-89.
doi: 10.1093/nar/gki1014 |
10. |
Elatmani H, Dormoy-Raclet V, Dubus P , et al. The RNA-binding protein UNR prevents mouse embryonic stem cells differentiation toward the primitive endoderm lineage. Stem Cells 2011; 29(10):1504-16. doi: 10.1002/stem.712.
doi: 10.1002/stem.712 |
11. |
Dinur M, Kilav R, Sela-Brown A , et al. In vitro evidence that upstream of N-ras participates in the regulation of parathyroid hormone messenger ribonucleic acid stability. Mol Endocrinol 2006; 20(7):1652-60.
doi: 10.1210/me.2005-0333 |
12. |
Kobayashi H, Kawauchi D, Hashimoto Y , et al. The control of precerebellar neuron migration by RNA-binding protein Csde1. Neuroscience 2013; 253:292-303. doi: 10.1016/j.neuroscience.2013.08.055.
doi: 10.1016/j.neuroscience.2013.08.055 pmid: 24012837 |
13. |
Ju Lee H, Bartsch D, Xiao C , et al. A post-transcriptional program coordinated by CSDE1 prevents intrinsic neural differentiation of human embryonic stem cells. Nat Commun 2017; 8(1):1456. doi: 10.1038/s41467-017-01744-5.
doi: 10.1038/s41467-017-01744-5 |
14. |
Horos R, Ijspeert H, Pospisilova D , et al. Ribosomal deficiencies in Diamond-Blackfan anemia impair translation of transcripts essential for differentiation of murine and human erythroblasts. Blood 2012; 119(1):262-72. doi: 10.1182/blood-2011-06-358200.
doi: 10.1182/blood-2011-06-358200 |
15. |
Xia K, Guo H, Hu Z , et al. Common genetic variants on 1p13.2 associate with risk of autism. Mol Psychiatry 2014; 19(11):1212-9. doi: 10.1038/mp.2013.146.
doi: 10.1038/mp.2013.146 pmid: 24189344 |
16. |
Wurth L, Papasaikas P, Olmeda D , et al. UNR/CSDE1 drives a post-transcriptional program to promote melanoma invasion and metastasis. Cancer Cell 2016; 30(5):694-707. doi: 10.1016/j.ccell.2016.10.004.
doi: 10.1016/j.ccell.2016.10.004 pmid: 27908735 |
17. |
Martinez-Useros J, Georgiev-Hristov T, Fernandez-Acenero MJ , et al. UNR/CDSE1 expression as prognosis biomarker in resectable pancreatic ductal adenocarcinoma patients: a proof-of-concept. PLoS One 2017; 12(8):e0182044. doi: 10.1371/journal.pone.0182044.
doi: 10.1371/journal.pone.0182044 |
18. |
Hu PS, Xia QS, Wu F , et al. NSPc1 promotes cancer stem cell self-renewal by repressing the synthesis of all-trans retinoic acid via targeting RDH16 in malignant glioma. Oncogene 2017; 36(33):4706-18. doi: 10.1038/onc.2017.34.
doi: 10.1038/onc.2017.34 |
19. |
Ray S, Anderson EC . Stimulation of translation by human Unr requires cold shock domains 2 and 4, and correlates with poly(A) binding protein interaction. Sci Rep 2016; 6:22461. doi: 10.1038/srep22461.
doi: 10.1038/srep22461 |
20. |
Dormoy-Raclet V, Markovits J, Malato Y , et al. UNR, a cytoplasmic RNA-binding protein with cold-shock domains, is involved in control of apoptosis in ES and HuH7 cells. Oncogene 2007; 26(18):2595-605.
doi: 10.1038/sj.onc.1210068 |
21. |
Tang Z, Li C, Kang B , et al. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res 2017; 45(W1):W98-W102. doi: 10.1093/nar/gkx247.
doi: 10.1093/nar/gkx247 pmid: 28407145 |
22. |
Zhang Y, Chao T, Li R , et al. MicroRNA-128 inhibits glioma cells proliferation by targeting transcription factor E2F3a. J Mol Med (Berl) 2009; 87(1):43-51. doi: 10.1007/s00109-008-0403-6.
doi: 10.1007/s00109-008-0403-6 pmid: 18810376 |
23. |
Legler JM, Ries LA, Smith MA , et al. Cancer surveillance series [corrected]: brain and other central nervous system cancers: recent trends in incidence and mortality. J Natl Cancer Inst 1999; 91(16):1382-90.
doi: 10.1093/jnci/91.16.1382 |
[1] | Lulu Ma, Xuerong Yu. Recurrent Myocardial Infarction and Catecholamine-Induced Cardiomyopathy: A Case Report [J]. Chinese Medical Sciences Journal, 2021, 36(2): 158-160. |
[2] | Zhang Xiufen, Yu Bo, Zhang Fuzheng, Guo Zijian, Li Lihua. microRNA-18a Promotes Cell Migration and Invasion Through Inhibiting Dicer l Expression in Hepatocellular Carcinoma In Vitro△ [J]. Chinese Medical Sciences Journal, 2017, 32(1): 34-43. |
[3] | Yan-ting Wang, Xiao-dong Yang, Shao-hua Liu, Yan-hua Huang. What Moved into the Lung? An Unusual Case of Foreign Body Migration [J]. Chinese Medical Sciences Journal, 2013, 28(4): 248-249. |
[4] | Bin Yin, Ke-han Li, Tai An, Tao Chen and Xiao-zhong Peng. Nectin-like Molecule 1 Inhibits the Migration and Invasion of U251 Glioma Cells by Regulating the Expression of An Extracellular Matrix Protein Osteopontin [J]. Chinese Medical Sciences Journal, 2010, 25(2): 100-104. |
[5] | Jin Wen, Han-Zhong Li, Zhi-gang Ji, Quan-zhong Mao, Bing-bing Shi and Wei-gang Yan. A Case of Large “Silent” Extra-adrenal Retroperitoneal Paraganglioma Resected Laparoscopically [J]. Chinese Medical Sciences Journal, 2010, 25(1): 61-64. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||
|
Supervised by National Health & Family Plan Commission of PRC
9 Dongdan Santiao, Dongcheng district, Beijing, 100730 China
Tel: 86-10-65105897 Fax:86-10-65133074
E-mail: cmsj@cams.cn www.cmsj.cams.cn
Copyright © 2018 Chinese Academy of Medical Sciences
All right reserved.
京公安备110402430088 京ICP备06002729号-1