Chinese Medical Sciences Journal ›› 2021, Vol. 36 ›› Issue (3): 225-233.doi: 10.24920/003834
• Original Article • Previous Articles Next Articles
Adiponectin Ameliorated Pancreatic Islet Injury Induced by Chronic Intermittent Hypoxia through Inhibiting the Imbalance in Mitochondrial Fusion and Division
Can He1, Xilong Zhang2, Qiang Zhang1, Luyao Ge1, Wenxiao Ding1, *(
)
- 1Department of Pulmonary and Critical Care Medicine, Zhongda Hospital, School of Medicine Southeast University, Nanjing 210009, China
2Department of Pulmonary and Critical Care Medicine, the First Affiliated; Hospital, Nanjing Medical University, Nanjing 210029, China
-
Accepted:2020-12-09Published:2021-09-30Online:2021-08-04 -
Contact:Wenxiao Ding E-mail:wenxiaoding@163.com
Cite this article
Can He, Xilong Zhang, Qiang Zhang, Luyao Ge, Wenxiao Ding. Adiponectin Ameliorated Pancreatic Islet Injury Induced by Chronic Intermittent Hypoxia through Inhibiting the Imbalance in Mitochondrial Fusion and Division[J].Chinese Medical Sciences Journal, 2021, 36(3): 225-233.
share this article
Add to citation manager EndNote|Reference Manager|ProCite|BibTeX|RefWorks
Table 1
The primer sequences of Drp1, Fis1, Mfn1, Opa1, Hmox1, Cs, Ant1, Cox4i1 and Gapdh"
| Primer | Forward | Reverse |
|---|---|---|
| Drp1 | 5’- ACTGGCCCCCGTCCAGCTTT -3’ | 5’- AGCTCCACACAGCGGAGGCT -3’ |
| Fis1 | 5’- GCACGCAGTTTGAATACGCC -3’ | 5’- CTGCTCCTCTTTGCTACCTTTGG -3’ |
| Mfn1 | 5’- CCTTGTACATCGATTCCTGGGTTC-3’ | 5’- CCTGGGCTGCATTATCTGGTG -3’ |
| Opa1 | 5’- CCTTGTACATCGATTCCTGGGTTC -3’ | 5’- CCTGGGCTGCATTATCTGGTG -3’ |
| Hmox1 | 5’- GTCAAGCACAGGGTGACAGA -3’ | 5’- CTGCAGCTCCTCAAACAGC -3’ |
| Cs | 5’- GCACGCCAGTGCTTCTTC -3’ | 5’- CATGCTGCTGTCTGAAGGTC -3’ |
| Ant1 | 5’- GTAGGATGATGATGCAGTCTGG -3’ | 5’- CGTCCTTCATCTTTTGCAATC -3’ |
| Cox4i1 | 5’- CACTGCGCTTGTGCTGAT -3’ | 5’- CGATCAAAGGTATGAGGGATG -3’ |
| Gapdh | 5’- GCCCTCACCACGTGGCCTTG -3’ | 5’- TGCAGCCCAGGGCCTTTGAC -3’ |
Table 1
Figure 1.
Results of oral glucose tolerance tests (OGTT) and insulin released test (IRT) of rats in NC, CIH, and CIH+APN group (n=20) (A) Dynamic changes in blood glucose of NC, CIH, and CIH+APN group. (B) Dynamic changes in insulin of NC, CIH, and CIH+APN group. NC, normal control; CIH, chronic intermittent hypoxia; APN, adiponectin."
Figure 1.
Figure 2.
Mitochondrial fusion and division of the NC, CIH, and CIH+APN group (A) The protein levels of DRP 1, FIS1, MFN1, and OPA1 of NC, CIH, and CIH+APN group. (B, C, D, E) The densitometric evalu-ations by the independent western blot of DRP1, FIS1, MFN1, and OPA1. (F, G, H, I) The mRNA expression levels of Drp1, Fis1, Mfn1, and Opa1 of the NC, CIH, and CIH + APN group. n=3. * P<0.05 compared to NC group; # P<0.05 compared to CIH group."
Figure 2.
Table 2
ATP level and MMP level of islets in NC, CIH, and CIH+APN group§"
| Measurements | NC group | CIH group | CIH+APN group | F | P value |
|---|---|---|---|---|---|
| ATP (nmol/mg) | 15.13±1.60 | 7.83±0.78* | 11.37±1.41*# | 23.38 | 0.0015 |
| MMP levels | 25.96±1.33 | 13.22±1.03* | 19.75±1.19*# | 86.04 | <0.0001 |
Table 2
Figure 3.
Comparison of mitochondrial tricarboxylic acid cycle function among NC, CIH, and CIH+APN group The mRNA levels of Ant1, Cs, Hmox1, Cox4i1 which implicate mitochondrial tricarboxylic acid cycle function of islets were significantly different among the three groups. n=3. *P<0.05 compared to NC group; # P<0.05 compared to CIH group."
Figure 3.
Figure 4.
The reactive oxygen species (ROS) levels (Mean Fluorescence Intensity) of islet detected by dihydroethidium staining (A) of NC group; (B) of CIH group; (C) of CIH+APN group. The intensity of red fluorescence indicates ROS level. n=3."
Figure 4.
Figure 5.
The expressions of proteins in mitochondria associated apoptosis pathway by western blot in NC, CIH, and CIH + APN group (A) The protein expressions of BAX, BCL-2, cleaved Caspase-3, and cleaved PARP by western blot. (B, C, D) The densitometric evaluation and comparison on BCL-2/BAX, cleaved Caspase-3, and cleaved PARP of the three groups. n=3. *P<0.05 compared to NC group; #P<0.05 compared to CIH group."
Figure 5.
| 1. |
Xie H, Yung WH. Chronic intermittent hypoxia-induced deficits in synaptic plasticity and neurocognitive functions: a role for brain-derived neurotrophic factor. Acta Pharmacol Sin 2012; 33(1):5-10. doi: 10.1038/aps.2011.184.
doi: 10.1038/aps.2011.184 |
| 2. |
Aurora RN, Crainiceanu C, Gottlieb DJ, et al. Obstructive sleep apnea during REM sleep and cardiovascular disease. Am J Respir Crit Care Med 2018; 197(5):653-60. doi: 10.1164/rccm.201706-1112OC.
doi: 10.1164/rccm.201706-1112OC |
| 3. |
Mazzotti DR, Keenan BT, Lim DC, et al. Symptom subtypes of obstructive sleep apnea predict incidence of cardiovascular outcomes. Am J Respir Crit Care Med 2019; 200(4):493-506. doi: 10.1164/rccm.201808-1509OC.
doi: 10.1164/rccm.201808-1509OC |
| 4. |
Goyal A, Gupta P. Obstructive sleep apnoea in patients with type 2 diabetes mellitus. Diabetes Res Clin Prac 2019; 160:107777. doi: 10.1016/j.diabres.2019.07.001.
doi: 10.1016/j.diabres.2019.07.001 |
| 5. |
Aurora RN, Punjabi NM. Obstructive sleep apnea, sleepiness, and glycemic control in Type 2 Diabetes. J Clin Sleep Med 2019; 15(5):749-55. doi: 10.5664/jcsm.7768.
doi: 10.5664/jcsm.7768 pmid: 31053205 |
| 6. |
Saad AMJ, Hiyasat D, Jaddou H, et al. The prevalence of high risk obstructive sleep apnoea among patients with type 2 diabetes in Jordan. Diabetes Res Clin Practice 2019; 152:16-22. doi: 10.1016/j.diabres.2019.04.035.
doi: 10.1016/j.diabres.2019.04.035 |
| 7. |
Sherwani SI, Aldana C, Usmani S, et al. Intermittent hypoxia exacerbates pancreatic beta-cell dysfunction in a mouse model of diabetes mellitus. Sleep 2013; 36(12):1849-58. doi: 10.5665/sleep.3214.
doi: 10.5665/sleep.3214 pmid: 24293759 |
| 8. |
Wang Y, Hai B, Niu X, et al. Chronic intermittent hypoxia disturbs insulin secretion and causes pancreatic injury via the MAPK signaling pathway. Biochem Cell Biol 2017; 95(3):415-20. doi: 10.1139/bcb-2016-0167.
doi: 10.1139/bcb-2016-0167 |
| 9. |
Orlando A, Nava E, Giussani M, et al. Adiponectin and cardiovascular risk. From pathophysiology to clinic: focus on children and adolescents. Int J Mol Sci 2019; 20(13):3228. doi: 10.3390/ijms20133228.
doi: 10.3390/ijms20133228 |
| 10. |
Fasshauer M, Bluher M. Adipokines in health and disease. Trends Pharmacol Sci 2015; 36(7):461-70. doi: 10.1016/j.tips.2015.04.014.
doi: 10.1016/j.tips.2015.04.014 pmid: 26022934 |
| 11. |
Long J, Su YX, Deng HC. Lipoapoptosis pathways in pancreatic beta-cells and the anti-apoptosis mechanisms of adiponectin. Horm Metab Res 2014; 46(10):722-7. doi: 10.1055/s-0034-1382014.
doi: 10.1055/s-0034-1382014 pmid: 25028793 |
| 12. |
Hu XF, Wang L, Lu YZ, et al. Adiponectin improves the osteointegration of titanium implant under diabetic conditions by reversing mitochondrial dysfunction via the AMPK pathway in vivo and in vitro. Acta Biomater 2017; 61:233-48. doi: 10.1016/j.actbio.2017.06.020.
doi: 10.1016/j.actbio.2017.06.020 |
| 13. |
Al Mutairi S, Mojiminiyi OA, Al Alawi A, et al. Study of leptin and adiponectin as disease markers in subjects with obstructive sleep apnea. Dis Markers 2014; 2014:706314. doi: 10.1155/2014/706314.
doi: 10.1155/2014/706314 pmid: 24982545 |
| 14. |
Finegood DT, McArthur MD, Kojwang D, et al. Beta-cell mass dynamics in Zucker diabetic fatty rats. Rosiglitazone prevents the rise in net cell death. Diabetes 2001; 50(5):1021-9. doi: 10.2337/diabetes.50.5.1021.
doi: 10.2337/diabetes.50.5.1021 pmid: 11334404 |
| 15. |
Lu X, Wang X, Xu T, et al. Circulating C3 and glucose metabolism abnormalities in patients with OSAHS. Sleep Breath 2018; 22(2):345-51. doi: 10.1007/s11325-017-1564-8.
doi: 10.1007/s11325-017-1564-8 |
| 16. |
Li CG, Ni CL, Yang M, et al. Honokiol protects pancreatic beta cell against high glucose and intermittent hypoxia-induced injury by activating Nrf2/ARE pathway in vitro and in vivo. Biomed Pharmacother 2018; 97:1229-37. doi: 10.1016/j.biopha.2017.11.063.
doi: 10.1016/j.biopha.2017.11.063 |
| 17. |
Detmer SA, Chan DC. Functions and dysfunctions of mitochondrial dynamics. Nature Rev Mol Cell Biol 2007; 8(11):870-79. doi: 10.1038/nrm2275.
doi: 10.1038/nrm2275 |
| 18. |
Youle RJ, van der Bliek AM. Mitochondrial fission, fusion, and stress. Science 2012; 337(6098):1062-5. doi: 10.1126/science.1219855.
doi: 10.1126/science.1219855 |
| 19. |
Taguchi N, Ishihara N, Jofuku A, et al. Mitotic phosphorylation of dynamin-related GTPase Drp1 participates in mitochondrial fission. J Biol Chem 2007; 282(15):11521-9. doi: 10.1074/jbc.M607279200.
doi: 10.1074/jbc.M607279200 pmid: 17301055 |
| 20. |
Han Q, Li G, Ip MS, et al. Haemin attenuates intermittent hypoxia-induced cardiac injury via inhibiting mitochondrial fission. J Cellular Mol Med 2018; 22(5):2717-26. doi: 10.1111/jcmm.13560.
doi: 10.1111/jcmm.13560 |
| 21. |
Ong SB, Subrayan S, Lim SY, et al. Inhibiting mitochondrial fission protects the heart against ischemia/reperfusion injury. Circulation 2010; 121(18):2012-22. doi: 10.1161/CIRCULATIONAHA.109.906610.
doi: 10.1161/CIRCULATIONAHA.109.906610 |
| 22. |
Liu X, Hajnoczky G. Altered fusion dynamics underlie unique morphological changes in mitochondria during hypoxia-reoxygenation stress. Cell Death Differ 2011; 18(10):1561-72. doi: 10.1038/cdd.2011.13.
doi: 10.1038/cdd.2011.13 pmid: 21372848 |
| 23. |
Alavi MV, Fuhrmann N. Dominant optic atrophy, OPA1, and mitochondrial quality control: understanding mitochondrial network dynamics. Mol Neurodegener 2013; 8:32. doi: 10.1186/1750-1326-8-32.
doi: 10.1186/1750-1326-8-32 |
| 24. |
Chen Y, Liu Y, Dorn GW 2nd. Mitochondrial fusion is essential for organelle function and cardiac homeostasis. Circ Res 2011; 109(12):1327-31. doi: 10.1161/CIRCRESAHA.111.258723.
doi: 10.1161/CIRCRESAHA.111.258723 pmid: 22052916 |
| 25. |
Nunnari J, Suomalainen A. Mitochondria: in sickness and in health. Cell 2012; 148(6):1145-59. doi: 10.1016/j.cell.2012.02.035.
doi: 10.1016/j.cell.2012.02.035 pmid: 22424226 |
| 26. |
Liu XR, Li T, Cao L, et al. Dexmedetomidine attenuates H2O2-induced neonatal rat cardiomyocytes apoptosis through mitochondria- and ER-medicated oxidative stress pathways. Mol Med Rep 2018; 17(5):7258-64. doi: 10.3892/mmr.2018.8751.
doi: 10.3892/mmr.2018.8751 |
| 27. |
Sas K, Szabo E, Vecsei L. Mitochondria, oxidative stress and the kynurenine system, with a Focus on ageing and neuroprotection. Molecules 2018; 23(1):191. doi: 10.3390/molecules23010191.
doi: 10.3390/molecules23010191 |
| 28. |
Koentges C, Konig A, Pfeil K, et al. Myocardial mitochondrial dysfunction in mice lacking adiponectin receptor 1. Basic Res Cardiol 2015; 110(4):37. doi: 10.1007/s00395-015-0495-4.
doi: 10.1007/s00395-015-0495-4 |
| 29. |
Kim EH, Park PH. Globular adiponectin protects rat hepatocytes against acetaminophen-induced cell death via modulation of the inflammasome activation and ER stress: Critical role of autophagy induction. Biochem Pharmacol 2018; 154:278-92. doi: 10.1016/j.bcp.2018.05.014.
doi: 10.1016/j.bcp.2018.05.014 |
| No related articles found! |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||
|
