CRISPR技术基因矫正乙型血友病来源iPS细胞的致病点突变并诱导肝系分化

doi:10.24920/J1001-9294.2017.032

Abstract

Objective

To genetically correct a disease-causing point mutation in human induced pluripotent stem cells (iPSCs) derived from a hemophilia B patient.

Methods

First, the disease-causing mutation was detected by sequencing the encoding area of human coagulation factor IX (F IX) gene. Genomic DNA was extracted from the iPSCs, and the primers were designed to amplify the eight exons of F IX. Next, the point mutation in those iPSCs was genetically corrected using CRISPR/Cas9 technology in the presence of a 129-nucleotide homologous repair template that contained two synonymous mutations. Then, top 8 potential off-target sites were subsequently analyzed using Sanger sequencing. Finally, the corrected clones were differentiated into hepatocyte-like cells, and the secretion of F IX was validated by immunocytochemistry and ELISA assay.

Results

The cell line bore a missense mutation in the 6^th coding exon (c.676 C>T) of F IX gene. Correction of the point mutation was achieved via CRISPR/Cas9 technology in situ with a high efficacy at about 22% (10/45) and no off-target effects detected in the corrected iPSC clones. F IX secretion, which was further visualized by immunocytochemistry and quantified by ELISA in vitro, reached about 6 ng/ml on day 21 of differentiation procedure.

Conclusions

Mutations in human disease-specific iPSCs could be precisely corrected by CRISPR/Cas9 technology, and corrected cells still maintained hepatic differentiation capability. Our findings might throw a light on iPSC-based personalized therapies in the clinical application, especially for hemophilia B.

Key words: hemophilia B, human induced pluripotent stem cells, CRISPR/Cas9, genetic correction, hepatic differentiation

He Qiong, Wang Hui-hui, Cheng Tao, Yuan Wei-ping, Ma Yu-po, Jiang Yong-ping, Ren Zhi-hua. Genetic Correction and Hepatic Differentiation of Hemophilia B-specific Human Induced Pluripotent Stem Cells[J].Chinese Medical Sciences Journal, 2017, 32(3): 135-144.

Figures/Tables 8

Table 1

Table 2

Table 3

Figure 1.

Figure 2.

Figure 3.

Figure 4.

Figure 5.

References 37.

1.	Chen Y, Schroeder JA, Kuether EL, Zhang G, Shi Q.Platelet gene therapy by lentiviral gene delivery to hematopoietic stem cells restores hemostasis and induces humoral immune tolerance in FIX(null) mice. Mol Ther 2014; 22(1):169-77. doi: 10.1038/mt.2013.197.
2.	Li T, Miller CH, Driggers J, Payne AB, Elliingsen D, Hooper WC.Mutation analysis of a cohort of US patients with hemophilia B. Am J Hematol 2014; 89(4):375-9. doi: 10.1002/ajh.23645.
3.	Bowen DJ.Haemophilia A and haemophilia B: molecular insights. Mol Pathol 2002; 55(1):1-18. doi: 10.1136/mp. 55.1.1.
4.	Seo JY, Jang MA, Kim HJ, Lee KO, Kim SH, Kim HJ.Sequence variation data of F8 and F9 genes in functionally validated control individuals: implications on the molecular diagnosis of hemophilia. Blood Res 2013; 48(3): 206-10. doi: 10.5045/br.2013.48.3.206.
5.	Takahashi K, Yamanaka S.Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006; 126(4):663-76. doi: 10.1016/ j.cell.2006.07.024.
6.	Takahashi K, Okita K, Nakagawa M, Yamanaka S.Induction of pluripotent stem cells from fibroblast cultures. Nat Protoc 2007; 2(12):3081-9. doi: 10.1038/nprot.2007. 418.
7.	Yamanaka S. Induction of pluripotent stem cells from mouse fibroblasts by four transcription factors. Cell Prolif 2008; 41 Suppl 1:51-6. doi: 10.1111/j.1365-2184.2008. 00493.x.
8.	Iwamuro M, Komaki T, Kubota Y, Seita M, Kawamoto H, Yuasa T, et al.Comparative analysis of endoderm formation efficiency between mouse ES cells and iPS cells. Cell Transplant 2010; 19(6):831-9. doi: 10.3727/096368 910X508951.
9.	Song Z, Cai J, Liu Y, Zhao D, Yong J, Duo S, et al.Efficient generation of hepatocyte-like cells from human induced pluripotent stem cells. Cell Res 2009; 19(11):1233-42. doi: 10.1038/cr.2009.107.
10.	Paques F, Duchateau P.Meganucleases and DNA double-strand break-induced recombination: perspectives for gene therapy. Curr Gene Ther 2007; 7(1):49-66. doi: 10.2174/156652307779940216.
11.	Carroll D.Genome engineering with zinc-finger nucleases. Genetics 2011; 188(4):773-82. doi: 10.1534/genetics. 111.131433.
12.	Wright DA, Li T, Yang B, Spalding MH.TALEN-mediated genome editing: prospects and perspectives. Biochem J 2014; 462(1):15-24. doi: 10.1042/BJ20140295.
13.	Doudna JA, Charpentier E.Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 2014; 346(6213):1258096. doi: 10.1126/science. 1258096.
14.	Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F.Genome engineering using the CRISPR-Cas9 system. Nat Protoc 2013; 8(11):2281-308. doi: 10.1038/nprot.2013. 143.
15.	Hsu PD, Lander ES, Zhang F.Development and applications of CRISPR-Cas9 for genome engineering. Cell 2014; 157(6):1262-78. doi: 10.1016/j.cell.2014.05.010.
16.	Si-Tayeb K, Noto FK, Nagaoka M, Li J, Battle MA, Duris C, et al.Highly efficient generation of human hepatocyte- like cells from induced pluripotent stem cells. Hepatology 2010; 51(1):297-305. doi: 10.1002/hep.23354.
17.	Jinek M, East A, Cheng A, Lin S, Ma E, Doudna J.RNA-programmed genome editing in human cells. Elife 2013; 2:e00471. doi: 10.7554/eLife.00471.
18.	Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E.A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012; 337(6096):816-21. doi: 10.1126/science.1225829.
19.	Cone L, Ran FA, Cox D, Lin S, Barretto R, Habib N, et al.Multiplex genome engineering using CRISPR/Cas systems. Science 2013; 339(6121):819-23. doi: 10.1126/ science.1231143.
20.	Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, et al. RNA-guided human genome engineering via Cas9. Science 2013; 339(6121):823-6. doi: 10.1126/science. 1232033.
21.	Tabebordbar M, Zhu K, Cheng JK, Chew WL, Widrick JJ, Yan WX, et al. In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science 2016; 351(6271): 407-11. doi: 10.1126/science.aad5177.
22.	Yin H, Xue W, Chen S, Bogorad RL, Benedetti E, Grompe M, et al.Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype. Nat Biotechnol 2014; 32(6):551-3. doi: 10.1038/nbt.2884.
23.	Ding Q, Strong A, Patel KM, Ng SL, Gosis BS, Regan SN, et al.Permanent alteration of PCSK9 with in vivo CRISPR-Cas9 genome editing. Circ Res 2014; 115(5): 488-92. doi: 10.1161/CIRCRESAHA.115.304351.
24.	Lin SR, Yang HC, Kuo YT, Liu CJ, Yang TY, Sung KC, et al.The CRISPR/Cas9 system facilitates clearance of the intrahepatic HBV templates in vivo. Mol Ther Nucleic Acids 2014; 3:e186. doi: 10.1038/mtna.2014.38.
25.	Guan Y, Ma Y, Li Q, Sun Z, Ma L, Wu L, et al.CRISPR/Cas9-mediated somatic correction of a novel coagulator factor IX gene mutation ameliorates hemophilia in mouse. EMBO Mol Med 2016; 8(5):477-88. doi: 10.15252/emmm.201506039.
26.	Xie F, Ye L, Chang JC, Beyer AI, Wang J, Muench MO, et al.Seamless gene correction of b-thalassemia mutations in patient-specific iPSCs using CRISPR/Cas9 and piggyBac. Genome Res 2014; 24(9):1526-33. doi: 10.1101/gr. 173427.114.
27.	Schwank G, Koo BK, Sasselli V, Dekkers JF, Heo I, Demircan T, et al.Functional repair of CFTR by CRISPR/Cas9 in intestinal stem cell organoids of cysticfibrosis patients. Cell Stem Cell 2013; 13(6):653-8. doi: 10.1016/j.stem.2013.11.002.
28.	Li HL, Fujimoto N, Sasakawa N, Shirai S, Ohkame T, Sakuma T, et al.Precise correction of the dystrophin gene in duchenne muscular dystrophy patient induced pluripotent stem cells by TALEN and CRISPR-Cas9. Stem Cell Rep 2015; 4(1):143-54. doi: 10.1016/j.stemcr.2014. 10.013.
29.	Ousterout DG, Kabadi AM, Thakore PI, Majoros WH, Reddy TE, Gersbach CA.Multiplex CRISPR/Cas9-based genome editing forcorrectionofdystrophin mutations that cause Duchenne muscular dystrophy. Nat Commun 2015; 6:6244. doi: 10.1038/ncomms7244.
30.	Fu Y, Foden JA, Khayter C, Maeder ML, Reyon D, Joung JK, et al.High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol 2013; 31(9):822-6. doi: 10.1038/nbt.2623.
31.	Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V, et al.DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol 2013; 31(9):827-32. doi: 10.1038/nbt.2647.
32.	Wu XB, Andrea JK, Philip AS.Target specificity of the CRISPR-Cas9 system. Quant Biol 2014, 2(2):59-70. doi: 10.1007/s40484-014-0030-x.
33.	Ashrani AA, Reding MT, Shet A, Osip J, Humar A, Lake JR, et al.Successful liver transplantation in a patient with severe haemophilia A and a high-titre factor Ⅷ inhibitor. Haemophilia 2004; 10(6):735-7. doi: 10.1111/j.1365-2516. 2004.01030.x.
34.	Wilde J, Teixeira P, Bramhall SR, Gunson B, Mutimer D, Mirza DF.Liver transplantation in haemophilia. Br J Haematol 2002; 117(4):952-6. doi: 10.1046/j.1365-2141. 2002.03528.x.
35.	Gordon FH, Mistry PK, Sabin CA, Lee CA.Outcome of orthotopic liver transplantation in patients with haemophilia. Gut 1998; 42(5):744-9. doi: 10.1136/gut.42.5.744.
36.	Nathwani AC, Reiss UM, Tuddenham EG, Rosales C, Chowdary P, McIntosh J, et al. Long-term safety and efficacy of factor IX gene therapy in hemophilia B. N Engl J Med 2014; 371(21):1994-2004. doi: 10.1056/NEJMoa 1407309.
37.	Sharma A, Easow MM, Sriganesh V, Neely JA, Kalipatnapu S. Gene therapy for haemophilia. Cochrane Database Syst Rev 2014; 11:CD010822. doi: 10.1002/ 14651858.CD010822.pub2.

Exons	Primer sequences	Product length (bp)
Exon 1	Forward: CCACTGCCCATTCTCTTCA Reverse: TACTTACCAACCTGCGTGCT	393
Exon 2+3	Forward: CATGCCCTAAAGAGAAATTGG Reverse: TGGGTTAGAGGGTTGGACTG	639
Exon 4	Forward: TCAGGAAGACAGGAGCATCA Reverse: GAGGGAAACTTTGAACCATGAG	322
Exon 5	Forward: ACCCATACATGAGTCAGTAGTTCC Reverse: GACACAGAAAGAATTCAGGTTGTAG	427
Exon 6	Forward: AATACTGATGGGCCTGCTTC Reverse: ACCTGGCCTGTGTCTTGC	383
Exon 7	Forward: GCCTATTCCTGTAACCAGCAC Reverse: GACCCTTCTGCCTTTAGCC	324
Exon 8	Forward: CAATTAGGTCAGTGGTCCCAAG Reverse: GGGAAAGTGATTAGTTAGTGAGAGG	713

No.	Off-target site	Primers
OT 1	GACAGCAGTTTGGTTGTTGG GAG	Forward: gttaattcccactcctgaagaga Reverse: tggttaaaaactctcaggcagc
OT 2	GCCTCCTCTTGGGTTGTTTG GAG	Forward: ttctttagatcattttatttaaaaacagtgc Reverse: aatcaccccattcaggtctaa
OT 3	GGCTTCCCATGAGTTGTTGG CAG	Forward: tcctctaccacgtgggctac Reverse: agagtccaggcttgaaccac
OT 4	CACTGCACTGGGGTTCTTGG GGG	Forward: cggaccccagactcttccta Reverse: aagcttccagaggacggtgg
OT 5	GAGTGCACTTGGGTGGCTGG AGG	Forward:acccagtcctcacttggtta Reverse: acagccttcagtgcagtcct
OT 6	AGCTTCATTTGGGTTGTTGG AAG	Forward: actcacctaacaaaagctctttcaa Reverse: tccctgcctccctgtcttta
OT 7	AATTTCTCTTGGGTTGTTGG GAG	Forward: tcgttatttttgtaaggctccta Reverse: aacactaatccatgagatctgaaaa
OT 8	GGCTGCACTTGGGTTGTTTG AGG	Forward: tgcctactgacaacaagagca Reverse: aagggacagggtgaaagagg

Antigen	Distributor	Host	Cat#	Dilution
OCT3/4	Santa Cruz	Rabbit	sc-9081	1:500
SOX17	ABCAM	Mouse	Ab84990	1:50-100
AFP	ABCAM	Rabbit	ab169552	1:100-250
ALB	R&D System	Mouse	MAB1455	8-25 μg/ml
F IX (F9)	Life science products & services	Rabbit	AB21319a	1:25-100
Fluorescein (FITC)-conjugated AffiniPure F(ab’) 2 Fragment Donkey Anti-Mouse IgG (H+L)	Jackson ImmunoResearch Laboratories	Donkey	715-096-150	1:50-200
Cy^TM3-conjugated AffiniPure F(ab’)2 Fragment Donkey Anti-Rabbit IgG (H+L)	Jackson ImmunoResearch Laboratories	Donkey	711-166-152	1:100-800

Early edition

Current issue

Archive

Specialties & Topics

Author center

Reviewer center

Genetic Correction and Hepatic Differentiation of Hemophilia B-specific Human Induced Pluripotent Stem Cells

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 8

References 37.

Related Articles 0

Metrics

Recommended 10