血清外泌体中CDK6和RHOU mRNA可作为无功能垂体腺瘤侵袭性的标志物

doi:10.24920/003585

Highlight

In this article, the authors explored circulating biomarkers for screening the invasiveness of non-functioning pituitary adenomas, and found both CDK6 and RHOU showed significantly higher relative expression in invasive pituitary adenomas as compared to non-invasive pituitary adenomas, suggesting CDK6 and RHOU mRNA in serum exosomes can be used as markers for predicting invasiveness of pituitary adenomas, and combination of the two genes performs better.

Abstract

Objective To explore circulating biomarkers for screening the invasiveness of non-functioning pituitary adenomas (NF-PAs).

Methods The exosomal RNAs were extracted from serum of patients with invasive NF-PA (INF-PA) or noninvasive NF-PA (NNF-PA). Droplet digital PCR was adapted to detect the mRNA expression of candidate genes related to tumor progression or invasion, such as cyclin dependent kinase 6 (CDK6), ras homolog family member U (RHOU), and spire type actin nucleation factor 2 (SPIRE2). Student’s t-test was used to analyze the statistical difference in the mRNA expression of candidate genes between the two groups. Receiver operating characteristic (ROC) curve was used to establish a model for predicting the invasiveness of NF-PAs. The accuracy, sensitivity, specificity and precision of the model were then obtained to evaluate the diagnostic performance.

Results CDK6 (0.2600±0.0912 vs. 0.1789±0.0628, t=3.431, P=0.0013) and RHOU mRNA expressions (0.2696±0.1118 vs. 0.1788±0.0857, t=2.946, P=0.0052) were upregulated in INF-PAs patients’ serum exosomes as compared to NNF-PAs. For CDK6, the area under the ROC curve (AUC) was 0.772 (95% CI: 0.600-0.943, P=0.005), the accuracy, sensitivity, specificity and precision were 77.27%, 83.33%, 75.00% and 55.56% to predict the invasiveness of NF-PAs. For RHOU, the AUC was 0.757 (95% CI: 0.599-0.915, P=0.007), the accuracy, sensitivity, specificity and precision were 72.73%, 83.33%, 68.75% and 50.00%. In addition, the mRNA levels of CDK6 and RHOU in serum exosomes were significantly positively correlated (r=0.935, P<0.001). After combination of the cut-off scores of the two genes, the accuracy, sensitivity, specificity and precision were 81.82%, 83.33%, 81.25% and 62.50%.

Conclusions CDK6 and RHOU mRNA in serum exosomes can be used as markers for predicting invasiveness of NF-PAs. Combination of the two genes performs better in distinguishing INF-PAs from NNF-PAs. These results indicate CDK6 and RHOU play important roles in the invasiveness of NF-PAs, and the established diagnostic method is valuable for directing the clinical screening and postoperative treatment.

Key words: pituitary adenoma, invasiveness, exosome, droplet digital PCR, biomarkers, RHOU, CDK6

Yu Shan, Wang Xiaoshuang, Cao Kaican, Bao Xinjie, Yu Jia. Identification of CDK6 and RHOU in Serum Exosome as Biomarkers for the Invasiveness of Non-functioning Pituitary Adenoma[J].Chinese Medical Sciences Journal, 2019, 34(3): 168-176.

Figures/Tables 7

Table 1

Table 2

Figure 1.

Figure 2.

Figure 3.

Table 3

Table 4

References 35.

1.	Asa SL, Ezzat S . The cytogenesis and pathogenesis of pituitary adenomas. Endocr Rev 1998; 19(6):798-827. doi: 10.1210/edrv.19.6.0350.
2.	Daly AF, Rixhon M, Adam C , et al. High prevalence of pituitary adenomas: a cross-sectional study in the province of Liege, Belgium. J Clin Endocrinol Metab 2006; 91(12):4769-75. doi: 10.1210/jc.2006-1668.
3.	Fernandez A, Karavitaki N, Wass JA . Prevalence of pituitary adenomas: a community-based, cross-sectional study in Banbury (Oxfordshire, UK). Clin Endocrinol (Oxf) 2010; 72(3):377-82. doi: 10.1111/j.1365-2265.2009.03667.x.
4.	Lopes MBS . The 2017 World Health Organization classification of tumors of the pituitary gland: a summary. Acta Neuropathol 2017; 134(4):521-35. doi: 10.1007/s00401-017-1769-8.
5.	Selman WR, Laws ER, Jr., Scheithauer BW , et al. The occurrence of dural invasion in pituitary adenomas. J Neurosurg 1986; 64(3):402-7. doi: 10.3171/jns.1986.64.3.0402.
6.	Thapar K, Kovacs K, Scheithauer BW , et al. Proliferative activity and invasiveness among pituitary adenomas and carcinomas: an analysis using the MIB-1 antibody. Neurosurgery 1996; 38(1):99-106; discussion 106-7. doi: 10.1097/00006123-199601000-00024.
7.	Raverot G, Burman P, McCormack A , et al. European Society of Endocrinology Clinical Practice Guidelines for the management of aggressive pituitary tumours and carcinomas. Eur J Endocrinol 2018; 178(1):G1-g24. doi: 10.1530/eje-17-0796.
8.	Boriachek K, Islam MN, Moller A , et al. Biological functions and current advances in isolation and detection strategies for exosome nanovesicles. Small 2018; 14(6). doi: 10.1002/smll.201702153.
9.	Vlassov AV, Magdaleno S, Setterquist R , et al. Exosomes: current knowledge of their composition, biological functions, and diagnostic and therapeutic potentials. Biochim Biophys Acta 2012; 1820(7):940-8. doi: 10.1016/j.bbagen.2012.03.017.
10.	Del Re M, Biasco E, Crucitta S , et al. The detection of androgen receptor splice variant 7 in plasma-derived exosomal RNA strongly predicts resistance to hormonal therapy in metastatic prostate cancer patients. Eur Urol 2017; 71(4):680-7. doi: 10.1016/j.eururo.2016.08.012.
11.	Knosp E, Steiner E, Kitz K , et al. Pituitary adenomas with invasion of the cavernous sinus space: a magnetic resonance imaging classification compared with surgical findings. Neurosurgery 1993; 33(4):610-7; discussion 7-8. doi: 10.1097/00006123-199310000-00008
12.	Corbisier P, Pinheiro L, Mazoua S , et al. DNA copy number concentration measured by digital and droplet digital quantitative PCR using certified reference materials. Anal Bioanal Chem 2015; 407(7):1831-40. doi: 10.1007/s00216-015-8458-z.
13.	Asa SL, Ezzat S . The pathogenesis of pituitary tumors. Annu Rev Pathol 2009; 4(1):97-126. doi: 10.1146/annurev.pathol.4.110807.092259.
14.	Sav A, Rotondo F, Syro LV , et al. Biomarkers of pituitary neoplasms. Anticancer Res 2012; 32(11):4639-54.
15.	Amar AP, Hinton DR, Krieger MD , et al. Invasive pituitary adenomas: significance of proliferation parameters. Pituitary 1999; 2(2):117-22.
16.	Knosp E, Kitz K, Perneczky A . Proliferation activity in pituitary adenomas: measurement by monoclonal antibody Ki-67. Neurosurgery 1989; 25(6):927-30. doi: 10.1227/00006123-198912000-00012
17.	Zhao X, Li J, Huang S , et al. MiRNA-29c regulates cell growth and invasion by targeting CDK6 in bladder cancer. Am J Transl Res 2015; 7(8):1382-9.
18.	Mendrzyk F, Radlwimmer B, Joos S , et al. Genomic and protein expression profiling identifies CDK6 as novel independent prognostic marker in medulloblastoma. J Clin Oncol 2005; 23(34):8853-62. doi: 10.1200/jco.2005.02.8589.
19.	Costello JF, Plass C, Arap W , et al. Cyclin-dependent kinase 6 (CDK6) amplification in human gliomas identified using two-dimensional separation of genomic DNA. Cancer Res 1997; 57(7):1250-4.
20.	Bax DA, Mackay A, Little SE , et al. A distinct spectrum of copy number aberrations in pediatric high-grade gliomas. Clin Cancer Res 2010; 16(13):3368-77. doi: 10.1158/1078-0432.Ccr-10-0438.
21.	Nagel S, Leich E, Quentmeier H , et al. Amplification at 7q22 targets cyclin-dependent kinase 6 in T-cell lymphoma. Leukemia 2008; 22(2):387-92. doi: 10.1038/sj.leu.2405028.
22.	Nebenfuehr S, Bellutti F, Sexl V . Cdk6: at the interface of Rb and p53. Mol Cell Oncol 2018; 5(5):e1511206. doi: 10.1080/23723556.2018.1511206.
23.	Lee KH, Lotterman C, Karikari C , et al. Epigenetic silencing of MicroRNA miR-107 regulates cyclin-dependent kinase 6 expression in pancreatic cancer. Pancreatology 2009; 9(3):293-301. doi: 10.1159/000186051.
24.	Lim JT, Mansukhani M, Weinstein IB . Cyclin-dependent kinase 6 associates with the androgen receptor and enhances its transcriptional activity in prostate cancer cells. Proc Natl Acad Sci U S A 2005; 102(14):5156-61. doi: 10.1073/pnas.0501203102.
25.	Wang G, Zheng L, Yu Z , et al. Increased cyclin-dependent kinase 6 expression in bladder cancer. Oncol Lett 2012; 4(1):43-6. doi: 10.3892/ol.2012.695. doi: 10.3892/ol.2012.695
26.	Symons M, Segall JE . Rac and Rho driving tumor invasion: who’s at the wheel? Genome Biol 2009; 10(3):213. doi: 10.1186/gb-2009-10-3-213.
27.	Liu S, Wang Y, Xue W , et al. Genetic variants in the genes encoding rho GTPases and related regulators predict cutaneous melanoma-specific survival. Int J Cancer 2017; 141(4):721-30. doi: 10.1002/ijc.30785.
28.	Vega FM, Ridley AJ . Rho GTPases in cancer cell biology. FEBS Lett 2008; 582(14):2093-101. doi: 10.1016/j.febslet.2008.04.039.
29.	Parri M, Chiarugi P . Rac and Rho GTPases in cancer cell motility control. Cell Commun Signal 2010; 8(1):23. doi: 10.1186/1478-811x-8-23.
30.	Simpson KJ, Dugan AS, Mercurio AM . Functional analysis of the contribution of RhoA and RhoC GTPases to invasive breast carcinoma. Cancer Res 2004; 64(23):8694-701. doi: 10.1158/0008-5472.Can-04-2247.
31.	Canovas Nunes S, Manzoni M, Pizzi M , et al. The small GTPase RhoU lays downstream of JAK/STAT signaling and mediates cell migration in multiple myeloma. Blood Cancer J 2018; 8(2):20. doi: 10.1038/s41408-018-0053-z.
32.	Bhavsar PJ, Infante E, Khwaja A , et al. Analysis of Rho GTPase expression in T-ALL identifies RhoU as a target for Notch involved in T-ALL cell migration. Oncogene 2013; 32(2):198-208. doi: 10.1038/onc.2012.42. doi: 10.1038/onc.2012.42
33.	Dart AE, Box GM, Court W , et al. PAK4 promotes kinase-independent stabilization of RhoU to modulate cell adhesion. J Cell Biol 2015; 211(4):863-79. doi: 10.1083/jcb.201501072.
34.	Hodge RG, Ridley AJ . Regulation and functions of RhoU and RhoV. Small GTPases 2017; 30:1-8. doi: 10.1080/21541248.2017.1362495.
35.	Faure S, Fort P . Atypical RhoV and RhoU GTPases control development of the neural crest. Small GTPases 2015; 6(4):174-7. doi: 10.1080/21541248.2015.1025943.

Gene name	Gene ID	Forward primer (5’-3’)	Reverse primer (5’-3’)	Probe (5’-3’)	Amplicon size (bp)
CDK6	1021	CTAGCAACCATCCCTCCATTAC	CTCAGAGCATTCTGAAGACAGTAG	ACACAGAAAGCCCTCTTGAAGCAA	104
RHOU	58480	GCAGGGAGGTGAATACTCTTG	GAAGTACATCTTGGCCGACTTA	AAGGCCAACAGCAAGTGTTTGTGGGA	92
SPIRE2	84501	GTCTGCACTTCCTGTAGCATAA	GATACCCTCTGAGGACTCTCAA	CACATCCCTGTCTACACACTGGGC	98
GAPDH	2597	GGTGTGAACCATGAGAAGTATGA	GAGTCCTTCCACGATACCAAAG	AGATCATCAGCAATGCCTCCTGCA	123

Groups	n	Age^§ (yrs)	Gender (male/female, n)	p53 (n)		Ki-67 (n)		Largest diameter^§ (mm)	Tumor texture (n)
Groups	n	Age^§ (yrs)	Gender (male/female, n)	Negative	Positive	≤3%	>3%	Largest diameter^§ (mm)	Hard	Soft	Other
NNF	32	47.28±16.30	13/19	30	2	27	5	21.19±7.68	9	21	2
INF	14	47.86±17.09	6/8	14	0	10	4	30.34±7.70	3	9	2
t/χ² value		0.1095^a	0.0200^b	0.0292^b		0.3777^b		3.7152^a	NA
P value		>0.9999^a	0.8875^b	0.8644^b		0.5388^b		0.0006^a	0.7717^c

Items	Database	ID	Background number	Corrected P-value	Input (gene ID)
G1/S transition of mitotic cell cycle	Gene Ontology	GO:0000082	230	0.0071	58480\|1021
Cell cycle G1/S phase transition	Gene Ontology	GO:0044843	240	0.0071	58480\|1021
Mitotic cell cycle phase transition	Gene Ontology	GO:0044772	447	0.0136	58480\|1021
Cell cycle phase transition	Gene Ontology	GO:0044770	473	0.0136	58480\|1021
Mitotic cell cycle process	Gene Ontology	GO:1903047	867	0.0182	58480\|1021
Mitotic cell cycle	Gene Ontology	GO:0000278	937	0.0182	58480\|1021
Cell cycle process	Gene Ontology	GO:0022402	1299	0.0182	58480\|1021
Cytoskeletal part	Gene Ontology	GO:0044430	1468	0.0182	58480\|1021
Cell cycle	Gene Ontology	GO:0007049	1665	0.0182	58480\|1021
Cell projection	Gene Ontology	GO:0042995	1772	0.0182	58480\|1021
Purine ribonucleoside triphosphate binding	Gene Ontology	GO:0035639	1788	0.0182	58480\|1021
Purine ribonucleoside binding	Gene Ontology	GO:0032550	1798	0.0182	58480\|1021
Ribonucleoside binding	Gene Ontology	GO:0032549	1801	0.0182	58480\|1021
Purine nucleoside binding	Gene Ontology	GO:0001883	1801	0.0182	58480\|1021
Nucleoside binding	Gene Ontology	GO:0001882	1808	0.0182	58480\|1021
Purine ribonucleotide binding	Gene Ontology	GO:0032555	1830	0.0182	58480\|1021
Purine nucleotide binding	Gene Ontology	GO:0017076	1843	0.0182	58480\|1021
Ribonucleotide binding	Gene Ontology	GO:0032553	1846	0.0182	58480\|1021
Cytoskeleton	Gene Ontology	GO:0005856	1983	0.0197	58480\|1021

[1]	Wei Yang, Mei Zhang. Biomarkers with Potential Predictive Value for Cardiotoxicity in Anticancer Treatments [J]. Chinese Medical Sciences Journal, 2021, 36(4): 333-341.
[2]	Yi Wang, Zhuhua Zhang, Wei Lian. Sudden Sensorineural Hearing Loss after Pituitary Adenoma Resection—A Case Series with Literature Review [J]. Chinese Medical Sciences Journal, 2021, 36(2): 120-126.
[3]	Weijia Wang, Le Shen, Labaciren , Hange Li, Yuelun Zhang, Yuguang Huang. Evaluation of Burnout Among Anesthesiologists Working in Tibet, China: Altitude and Attitude [J]. Chinese Medical Sciences Journal, 2021, 36(2): 97-102.
[4]	Wang Zhan, Wang Xu, Wang Wenda, Zheng Guoyang, Guo Hao, Zhang Yushi. Value of Preoperative Neutrophil-to-Lymphocyte Ratio in Predicting Prognosis of Surgically Resectable Urinary Cancers: Systematic Review and Meta-Analysis [J]. Chinese Medical Sciences Journal, 2020, 35(3): 262-271.
[5]	Wu Jianqiang, Qin Weiwei, Pan Li, Wang Xiaorong, Zhang Biao, Shan Guangliang, Gao Youhe. Regional Differences of the Urinary Proteomes in Healthy Chinese Individuals [J]. Chinese Medical Sciences Journal, 2019, 34(3): 157-167.

Early edition

Current issue

Archive

Specialties & Topics

Author center

Reviewer center

Identification of CDK6 and RHOU in Serum Exosome as Biomarkers for the Invasiveness of Non-functioning Pituitary Adenoma

RichHTML

PDF (PC)

Knowledge

Highlight

Abstract

Cite this article

share this article

Figures/Tables 7

References 35.

Related Articles 5

Metrics

Recommended 10

Items	CDK6	RHOU	Combination
Total	44	44	44
Positives (P, n)	12	12	12
Negatives (N, n)	32	32	32
True positives (TP, n)	10	10	10
False positives (FP, n)	8	10	6
False negatives (FN, n)	2	2	2
True negatives (TN, n)	24	22	26
Accuracy (%)	77.27	72.73	81.82
Sensitivity (%)	83.33	83.33	83.33
Specificity (%)	75.00	68.75	81.25
Precision (%)	55.56	50.00	62.50