筛选双氧水引起肥大软骨细胞中发生改变的基因

doi:10.24920/31801

Abstract

Objective To identify the osteogenesis genes whose expression is altered in hypertrophic chondrocytes treated with H₂O₂.Methods Murine chondrogenitor cells (ATDC5) were differentiated into hypertrophic chondrocytes by Insulin-Transferrin-Selenium (ITS) treatment, and then treated with H₂O₂. Suitable conditions (concentration, time) were determined by using the MTT assay. After total RNA isolation and cDNA synthesis, the levels of 84 genes were determined using the PCR array, whereas quantitative RT-PCR was carried out to validate the PCR array data.Results We identified 9 up-regulated genes and 12 down-regulated genes, encoding proteins with various functions, such as collagen proteins, transcription factors, proteins involved in skeletal development and bone mineral metabolism, as well as cell adhesion molecules. Quantitative RT-PCR confirmed the altered expression of 5 down-regulated genes (Smad2, Smad4, transforming growth factor β receptor 1, transforming growth factor β receptor 3, and matrix metalloproteinase 10).Conclusions H₂O₂ significantly changed the expression of several genes involved in a variety of biological functions. Because of the link between oxidative damage and Kashin-Beck disease, these genes may also be involved in the deep-zone necrosis of the cartilage observed in Kashin-Beck disease.

Key words: Kashin-Beck disease, hypertrophic chondrocytes, deep-zone necrosis, oxidative stress, H₂O₂

He Ying,Zhang Ying,Wang Mengying,Zhang Meng,Zhang Dan,Zhang Ying,Jiang Zhuocheng,Wu Feng,Chen Jinghong. Gene Expression Profile of Hypertrophic Chondrocytes Treated with H₂O₂: A Preliminary Investigation[J].Chinese Medical Sciences Journal, 2018, 33(1): 45-52.

Figures/Tables 7

References 39.

1.	Duan C, Guo X, Zhang XD, et al. Comparative analysis of gene expression profiles between primary knee osteoarthritis and an osteoarthritis endemic to Northwestern China, Kashin-Beck disease. Arthritis Rheumatol,2010; 62(3):771-80. doi:10.1002/art.27282. doi: 10.1002/art.27282 pmid: 20131229
2.	Zhang F, Guo X, Wang W, et al. Genome-wide gene expression analysis suggests an important role of hypoxia in the pathogenesis of endemic osteochondropathy Kashin-Beck Disease. PLoS One,2011; 6(7):e22983. doi:10.1371/journal.pone.0022983. doi: 10.1371/journal.pone.0022983 pmid: 21829570
3.	Zou K, Liu G, Wu T, et al. Selenium for preventing Kashin-Beck osteoarthropathy in children: a meta-analysis. Osteoarthritis Cartilage,2009; 17(2):144-51. doi:10.1016/j.joca.2008.06.011. doi: 10.1016/j.joca.2008.06.011 pmid: 18693119
4.	Zhang WH, Neve J, Xu JP, et al. Selenium, iodine and fungal contamination in Yulin District (People’s Republic of China) endemic for Kashin-Beck disease. Int Orthop,2001; 25(3):188-90. doi: 10.1007/s002640100242 pmid: 11482538
5.	Guan F, Li S, Wang ZL, et al. Histopathology of chondronecrosis development in knee articular cartilage in a rat model of Kashin-Beck disease using T-2 toxin and selenium deficiency conditions. Rheumatol Int,2013; 33(1):157-66. doi:10.1007/s00296-011-2335-7. doi: 10.1007/s00296-011-2335-7 pmid: 22258458
6.	Chen JH, Xue S, Li S, et al. Oxidant damage in Kashin-Beck disease and a rat Kashin-Beck disease model by employing T-2 toxin treatment under selenium deficient conditions. J Orthop Res 2012; 30:(8):1229-37. doi:10.1002/jor.22073. doi: 10.1002/jor.22073 pmid: 22294316
7.	Allander E . Kashin-Beck disease. An analysis of research and public health activities based on a bibliography. Scand J Rheumatol Suppl,1994; 99:1-36. doi: 10.3109/03009749409117126 pmid: 7801051
8.	Wang W, Wei S, Luo M, et al. Oxidative stress and status of antioxidant enzymes in children with Kashin-Beck disease. Osteoarthritis Cartilage,2013; 21(11):1781-9. doi:10.1016/j.joca.2013.08.002. doi: 10.1016/j.joca.2013.08.002
9.	Olszewska-Slonina DM, Matewski D, Drewa G, et al. Oxidative equilibrium in the prophylaxis of degenerative joint changes: an analysis of pre and postoperative activity of antioxidant enzymes in patient with hip and knee osteoarthritis. Med Sci Monit 2010; 16(5):CR238-45. doi: 10.1016/j.mehy.2009.07.026 pmid: 20424551
10.	Biniecka M, Kennedy A, Fearon U, et al. Oxidative damage in synovial tissue is associated with in vivo hypoxic status in the arthritic joint. Ann Rheum Dis,2010; 69(6):1172-8. doi:10.1136/ard.2009.111211. doi: 10.1136/ard.2009.111211 pmid: 19706618
11.	Grigolo B, Roseti L, Fiorini M, et al. Enhanced lipid peroxidation in synoviocytes from patients with osteoarthritis. J Rheumatol,2003; 30(2):345-7. doi: 10.1016/S1297-319X(02)00021-0 pmid: 12563693
12.	Liochev SI . Reactive oxygen species and the free radical theory of aging. Free Radic Biol Med,2013; 60:1-4. doi:10.1016/j.freeradbiomed.2013.02.011. doi: 10.1016/j.freeradbiomed.2013.02.011 pmid: 23434764
13.	Gao J, Deng Y, Yin C, et al. Icariside Ⅱ, a novel phosphodiesterase 5 inhibitor, protects against H2O2-induced PC12 cells death by inhibiting mitochondria-mediated autophagy. J Cell Mol Med,2017; 21(2):375-86. doi:10.1111/jcmm.12971. doi: 10.1111/jcmm.12971
14.	Lee JH, Jung HK, Han YS, et al. Antioxidant effects of Cirsium setidens extract on oxidative stress in human mesenchymal stem cells. Mol Med Rep,2016; 14(4):3777-84. doi:10.3892/mmr.2016.5706. doi: 10.3892/mmr.2016.5706 pmid: 5042755
15.	Boone DR, Micci MA, Taglialatela IG, et al. Pathway-focused PCR array profiling of enriched populations of laser capture microdissected hippocampal cells after traumatic brain injury. PLoS One,2015; 10(5):e0127287. doi:10.1371/journal.pone.0127287. doi: 10.1371/journal.pone.0127287 pmid: 26016641
16.	Zhang F, Dai L, Lin W, et al. Exome sequencing identified FGF12 as a novel candidate gene for Kashin-Beck disease. Funct Integr Genomics,2016; 16(1):13-7. doi:10.1007/s10142-015-0462-z. doi: 10.1007/s10142-015-0462-z pmid: 26290467
17.	Boone DR, Micci MA, Taglialatela IG, et al. Pathway-focused PCR array profiling of enriched populations of laser capture microdissected hippocampal cells after traumatic brain injury. PLoS One,2015; 10(5):e0127287. doi:10.1371/journal.pone.0127287. doi: 10.1371/journal.pone.0127287 pmid: 26016641
18.	Zhang F, Wen Y, Guo X, et al. Genome-wide association study identifies ITPR2 as a susceptibility gene for Kashin-Beck disease in Han Chinese. Arthritis Rheumatol,2015; 67(1):176-81. doi:10.1002/art.38898. doi: 10.1002/art.38898 pmid: 25303641
19.	Shen J, Li S, Chen D . TGF-β signaling and the development of osteoarthritis. Bone Res 2014; 2 pii: 14002. doi:10.1038/boneres.2014.2. doi: 10.1038/boneres.2014.2 pmid: 25541594
20.	Serra R, Johnson M, Filvaroff EH, et al. Expression of a truncated, kinase-defective TGF-beta type Ⅱ receptor in mouse skeletal tissue promotes terminal chondrocyte differentiation and osteoarthritis. J Cell Biol,1997; 139(2):541-52. doi: 10.1083/jcb.139.2.541
21.	Blaney Davidson EN, Remst DF, Vitters EL, et al. Increase in ALK1/ALK5 ratio as a cause for elevated MMP-13 expression in osteoarthritis in humans and mice. J Immunol,2009; 182(12):7937-45. doi:10.4049/jimmunol.0803991. doi: 10.4049/jimmunol.0803991 pmid: 19494318
22.	Dünker N, Krieglstein K . Targeted mutations of transforming growth factor-beta genes reveal important roles in mouse development and adult homeostasis. Eur J Biochem,2000; 2677(24):6982-8. doi: 10.1046/j.1432-1327.2000.01825.x pmid: 11106407
23.	van der Kraan P, Matta C, Mobasheri A . Age-related alterations in signaling pathways in articular chondrocytes: implications for the pathogenesis and progression of osteoarthritis―a mini-review. Gerontology,2016; 63(1):29-35. doi:10.1159/000448711. doi: 10.1159/000448711 pmid: 27595269
24.	Valdes AM, Spector TD, Tamm A, et al. Genetic variation in the SMAD3 gene is associated with hip and knee osteoarthritis. Arthritis Rheum,2010; 62(8):2347-52. doi:10.1002/art.27530. doi: 10.1002/art.27530 pmid: 20506137
25.	Niu W, Sun ZT, Cao XW, et al. Regulation of single herb pilose antler on the expression of Smad2 and Smad3 in the cartilage of OA rats: an experimental research. Zhongguo Zhong Xi Yi Jie He Za Zhi,2014; 34(2):209-13. pmid: 24672947
26.	Song B, Estrada KD, Lyons KM . Smad signaling in skeletal development and regeneration. Cytokine Growth Factor Rev,2009; 20(5-6):379-88. doi:10.1016/j.cytogfr.2009.10.010. doi: 10.1016/j.cytogfr.2009.10.010 pmid: 19926329
27.	Tremblay KD, Hoodless PA, Bikoff EK, et al. Formation of the definitive endoderm in mouse is a Smad2-dependent process. Development,2000; 127(14):3079-90. doi: 10.1007/s00534-005-0999-7 pmid: 10862745
28.	Weinstein M, Yang X, Li C, et al. Failure of egg cylinder elongation and mesoderm induction in mouse embryos lacking the tumor suppressor smad2. Proc Natl Acad Sci USA,1998; 95(16):9378-83. doi:10.1073/pnas.95.16.9378. doi: 10.1073/pnas.95.16.9378 pmid: 9689088
29.	Sirard C, de la Pompa JL, Elia A, et al. The tumor suppressor gene Smad4/Dpc4 is required for gastrula-tion and later for anterior development of the mouse embryo. Genes Dev,1998; 12(1):107-19. doi: 10.1101/gad.12.1.107
30.	Li J, Huang J, Dai L, et al. miR-146a, an IL-1β responsive miRNA, induces vascular endothelial growth factor and chondrocyte apoptosis by targeting Smad4. Arthritis Res Ther,2012; 14(2):R75. doi:10.1186/ar3798. doi: 10.1186/ar3798 pmid: 22507670
31.	Hughes OB, Rakosi A, Macquhae F, et al. A review of cellular and acellular matrix products: indications, techniques, and outcomes. Plast Reconstr Surg,2016; 138(3 Suppl):138S-47S. doi:10.1097/PRS.0000000000002643. doi: 10.1097/PRS.0000000000002643
32.	Pak J, Lee JH, Park KS, et al. Regeneration of cartilage in human knee osteoarthritis with autologous adipose tissue-derived stem cells and autologous extracellular matrix. Biores Open Access,2016; 5(1):192-200. doi:10.1089/biores.2016.0024. doi: 10.1089/biores.2016.0024
33.	Murphy G, Kn?uper V, Atkinson S, et al. Matrix metalloproteinases in arthritic disease. Arthritis Res 2002; 4 Suppl 3:S39-49. doi:10.1186/ar572. doi: 10.1186/ar572
34.	Zeng GQ, Chen AB, Li W, et al. High MMP-1, MMP-2, and MMP-9 protein levels in osteoarthritis. Genet Mol Res,2015; 14(4):14811-22. doi:10.4238/2015. doi: 10.4238/2015 pmid: 26600542
35.	Jackson MT, Moradi B, Smith MM, et al. Activation of matrix metalloproteinases 2, 9, and 13 by activated protein C in human osteoarthritic cartilage chondrocytes. Arthritis Rheumatol,2014; 66(6):1525-36. doi:10.1002/art.38401. doi: 10.1002/art.38401 pmid: 24574263
36.	Rohani MG , McMahan RS, Razumova MV, et al. MMP-10 regulates collagenolytic activity of alternatively activated resident macrophages. J Invest Dermatol,2015; 135(10):2377-84. doi:10.1038/jid.2015.167. doi: 10.1038/jid.2015.167 pmid: 25927164
37.	Appleton CT, Pitelka V, Henry J, et al. Global analyses of gene expression in early experimental osteoarthritis. Arthritis Rheum,2007; 56(6):1854-68. doi:10.1002/art.22711. doi: 10.1002/art.22711 pmid: 17530714
38.	Dahlberg L, Billinghurst RC, Manner P, et al. Selective enhancement of collagenase-mediated cleavage of resident type Ⅱ collagen in cultured osteoarthritic cartilage and arrest with a synthetic inhibitor that spares collagenase1 (matrix metalloproteinase 1). Arthritis Rheum,2000; 43(3):673-82. doi:10.1002/1529-0131(200003)43:3<673::AID-ANR25>3.0.CO;2-8 doi: 10.1002/1529-0131(200003)43:3<673::AID-ANR25>3.0.CO
39.	Kozawa E, Nishida Y, Cheng XW, et al. Osteoarthritic change is delayed in a Ctsk-knockout mouse model of osteoarthritis. Arthritis Rheum,2012; 64(2):454-64. doi:10.1002/art.33398. doi: 10.1002/art.33398 pmid: 21968827

Genes	Upstream primer (5’-3’)	Downstream primer (5’-3’)
GAPDH	GGGCTCATGACCACAGTCCATGC	CCTTGCCCACAGCCTTGGCA
Col X	ACGCATCTCCCAGCACCAGAATC	GGGGCTAGCAAGTGGGCCCT
Smad2	ATGTCGTCCATCTTGCCATTC	AACCGTCCTGTTTTCTTTAGCTT
Smad4	GAGAACATTGGATGGACGACT	CACAGACGGGCATAGATCAC
MMP10	GCAGCCCATGAACTTGGCCACT	AGGGACCGGCTCCATACAGGG
TGFβ2	GACCAGAAATTCCCAGCTTCT	CAACGTCTCACACACCATCTG
TGFβr1	TGCCATAACCGCACTGTCA	AATGAAAGGGCGATCTAGTGATG
TGFβr3	ATGGCAGTGACATCCCACCACAT	AGAACGGTGAAGCTCTCCATCA

No.	ID	Symbol	Description	Fold regulation
1	NM_009893	Chrd	Chordin	-2.38
2	NM_009931	Col4a1	Collagen, type XIV, alpha 1	-2.30
3	NM_009969	Csf2	Colony stimulating factor 2	-3.77
4	NM_007802	Ctsk	Cathepsin K	-4.80
5	NM_008610	MMP2	Matrix metallopeptidase 2	-3.54
6	NM_013599	MMP9	Matrix metallopeptidase 9	-3.37
7	NM_019471	MMP10	Matrix metallopeptidase 10	-2.29
8	NM_010754	Smad2	MAD homolog 2 (Drosophila)	-2.30
9	NM_008540	Smad4	MAD homolog 4 (Drosophila)	-2.08
10	NM_009367	Tgfb2	Transforming growth factor, beta 2	-3.47
11	NM_009370	Tgfbr1	Transforming growth factor, beta receptor 1	-459.31
12	NM_011578	Tgfbr3	Transforming growth factor, beta receptor 3	-2.32

NO.	ID	Symbol	Description	Fold regulation
1	NM_007394	Acvr1	Activin A receptor, type 1	3.47
2	NM_ 009673	Anxa5	Annexin A5	2.51
3	NM_007542	Bgn	Biglycan	2.98
4	NM_007561	Bmpr2	Bone morphogenic protein receptor, type 2	2.44
5	NM_181277	Col14a1	Collagen, type XIV, alpha 1	2.31
6	NM_011077	Phex	Phosphate regulating gene with homologies to endopeptidases on the X chromosome	4.37
7	NM_009263	Spp1	Secreted phosphoprotein 1	4.25
8	NM_009504	Vdr	Vitamin D receptor	2.34
9	NM_011697	Vegfb	Vascular endothelial growth factor B	2.17

[1]	Rongqiang Zhang, Dandan Zhang, Di Zhang, Xiaoli Yang, Qiang Li, Chen Wang, Xuena Yang, Yongmin Xiong. Crosstalk between CpG Methylation and Polymorphisms (CpG-SNPs) in the Promotor Region of DIO2 in Kashin-Beck Disease [J]. Chinese Medical Sciences Journal, 2022, 37(1): 52-59.
[2]	Ping Fen, Cao Qin, Lin Hua, Han Shuzhi. Antagonistic Effects of N-acetylcysteine on Mitogen-activated Protein Kinase Pathway Activation, Oxidative Stress and Inflammatory Responses in Rats with PM_2.5 Induced Lung Injuries [J]. Chinese Medical Sciences Journal, 2019, 34(4): 270-276.
[3]	Pan Yanfang, Jia Xiaotao, Song Erfei, Peng Xiaozhong. Astragaloside IV Protects Against Aβ1-42-induced Oxidative Stress, Neuroinflammation and Cognitive Impairment in Rats [J]. Chinese Medical Sciences Journal, 2018, 33(1): 29-37.
[4]	Kong Xiangyi, Guan Jian, Gong Shun, Wang Renzhi. Neuroprotective Effects of Grape Seed Procyanidin Extract on Ischemia-Reperfusion Brain Injury^△ [J]. Chinese Medical Sciences Journal, 2017, 32(2): 92-99.
[5]	Fen Ping, Zhen-sheng Li, Feng-rui Zhang, De-xin Li, Shu-zhi Han. Effects of Lianhua Qingwen on Pulmonary Oxidative Lesions Induced by Fine Particulates (PM2.5) in Rats [J]. Chinese Medical Sciences Journal, 2016, 31(4): 233-238.

Early edition

Current issue

Archive

Specialties & Topics

Author center

Reviewer center

Gene Expression Profile of Hypertrophic Chondrocytes Treated with H₂O₂: A Preliminary Investigation

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 7

References 39.

Related Articles 5

Metrics

Recommended 10